Is protection against infection by HIV possible?


By Klaus D. Linse

Wouldn’t it be cool to have a vaccine available to prevent infection by the HIV virus?

Many research groups are feverishly working to devise a vaccine against the AIDS virus. But is this really achievable in the near future? Recent progress made in the field of AIDS research suggests that this may be possible in the not too distant future.

The AIDS virus has infected approximately 33 million people globally and killed more than 25 million since the 1980s. Presently cocktails made of strong drugs can suppress the virus and keep patients healthy. However, these drugs have some undesirable side effects such as nausea, diarrhea, headache, peripheral nerve damage and body fat redistribution which tend to worsen over time and there is no vaccine against the virus available yet.

A gene called CCR5-D32 coding for the cysteine-cysteine chemokine receptor 5 (CCR5) appears to prevent the human immunodeficiency virus (HIV) from entering cells. Two copies of the gene seem to give almost complete immunity from HIV to its carrier. One copy of the gene significantly inhibits the virus’s ability to multiply in the cells. This reduces the viral load in people who carry the gene and become infected thereby slowing the progression of AIDS. Genetic research has shown that CCR5-D32 is almost completely absent in Africans but it occurs in 5 to 10 percent of Caucasians. A theoretical model of the CCR5 receptor is shown below.

CCR5 model

Theoretical model of the CCR5 receptor

   Da and Wu used the X-ray structure of CXCR4 to produce a theoretical model of the CCR5 receptor. This model of the CCR5 receptor is depicted in the left panel and the model of the CCR5 receptor embedded in the membrane is depicted to the right. (Source: http://en.wikipedia.org/wiki/CCR5#p-search); Da and Wu 2011). Da and Wu developed the theoretical model for the CCR5-gp120 complex recently. In this model, the N-terminus of CCR5 binds to three discontinuous domains of the glycoprotein gp120, including the fourth conserved (C4) region, the β19/β20 connecting loop, and the V3 loop. In the model the second extra-cellular loop (ECL2) of CCR5 also interacts with the crown part of the gp120 V3 loop. The researchers report that their results are in accord with experimental observations and provide a structural basis for the design of CCR5 antagonists.

Why are some people resistant or even virtually immune to the AIDS virus? Recent studies suggest that the roots of the immunity against AIDS extend back for centuries, longer than the existence of the disease itself. Furthermore, our ethnic background appears to play a crucial role in whether our genes will allow HIV to take hold in our bodies. One of the most powerful forms of resistance is limited to people with Northern European or Central Asian heritage. One percent of people with this ethnic background are virtually immune to being infected by HIV. Faure and Royer-Carenzi in 2008 studied the geographic distribution of the HIV-1 resistant CCR5-D32 allele and found that this allele is mainly present in Europeans (> 10%) and that its frequency is highest (>15%) in the areas surrounding the Baltic and White Seas as well as in Central Russia near Novosibirsk. Ancient DNA evidence suggests that this allele is at least 2900 years old in Germany and studies of Scandinavian Mesolithic DNA suggest that its first occurrence might even date back to around 5000 BC. From the maximum the frequency gradually decreases in all directions across Europe. Some researchers suggested that the features of this geographic distribution imply a Viking origin resulting in the “Viking hypothesis” of origin of the mutation. However, Luccotte and Dieterlen in 2003 suggest that according to haplotype analysis this mutation originated quite recently, circa 700 (with an error margin of ca. 500 years) or more years ago at a single point in northwestern Europe. This view suggests that the allele was present in Scandinavia and that the Vikings spread it northward to Island, eastward to Russia and southward to Central and Southern Europe during their travels and raiding in Europe in the 800s. The following map shows the present day world-wide distribution of the allele frequency. Faure & Royer-Carenzi in 2008 suggest that this geography of the allele distribution could indicate that a human disease or zoonosis that favored the CCR5-D32 mutation could have played a role. The latest view appears to be that this allele protects its carrier from being infected by the West Nile virus as well and that the early Indo-Europeans that were exposed to the West Nile virus may have carried it during their spread into Europe.

CCR5 delta32 distribution

World-wide frequency distribution of CCR5-D32 allele frequencies.

(Source Faure & Royer-Carenzi 2008).

   The gene that codes for CCR5 is located on human chromosome 3 and various mutations are known that change the function of the expressed receptor. The CCR5-D32 mutationresults from a deletion of a sequence of 32 base-pairs. This mutant form of the gene results in a receptor with no function. The CCR5 receptor is present in the cell membranes of many types of mammalian cells as well as in nerve and white blood cells. This receptor allows entry of signaling chemokines into the cell. It is a seven-transmembrane, G protein-coupled receptor (GPCR) involved in regulating trafficking and effector functions of memory/effector T-lymphocytes, macrophages, and immature dendritic cells. It is the main coreceptor for the entry of R5 strains of human immunodeficiency virus (HIV-1, HIV-2).

Can replacing the infected bone marrow of an infected patient with the bone marrow from a healthy person carrying the CCR5-D32 allele cure the disease! It appears that this is the case.

In recent years German researchers reported in the news that they used a bone marrow transplant to treat a cancer patient who was infected with the AIDS virus. The patient, who had both HIV infection and leukemia, received the bone marrow transplant in 2007 from a donor who had a genetic mutation known to give patients a natural immunity to the virus. According to recent news the patient is now free of the virus and the virus does not appear to be hiding anywhere in his body. However, this treatment requires the destruction of a patient’s own bone marrow followed by the transplantation of the bone marrow from a donor who has a near-exact blood and immune system type that carries the CCR5-D32 allele. Furthermore, many months of recovery are needed (Source: http://www.reuters.com/article/2010/12/15/us-aids-transplant-idUSTRE6BE68220101215).

Is gene therapy the solution for a cure?

In addition, Jin et al in 2008 reported that lentivirus vector-mediated delivery of the CCR5-D32 gene provides resistant to human immunodeficiency virus type 1 (HIV-1). Their study, using immortalized human peripheral blood mononuclear cells (PBMCs), showed that long-term expression of CCR5-D32 confers resistance to HIV-1 and that this method may offer a useful stem cell- or T-cell based gene therapy for HIV-1 infected people. These findings suggest that there is hope for a potential cure of the disease in the future. However, there is evidence that additional mechanisms may have evolved in Caucasians to protect against HIV-1 infections as well. Veloso et al reported in 2010 that they found evidence that a group of long-term non-progressor Caucasian Spaniards infected with HIV-1 apparently were protected against the virus without the help of the tumor necrosis factor alpha and the CCR5-D32 receptor variant.

In a paper published in the January volume of the journal Nature Balazs et al. report the successful use of an alternative to immunization. The researchers showed that a vector-mediated gene transfer could be used to engineer secretion of existing broadly neutralizing antibodies into the blood circulation of mice. They call the approach a “vectored immunoprophylaxis” (VIP) and showed that it induces in mice lifelong expression of these monoclonal antibodies at high concentrations resulting from a single intramuscular injection. The research group designed a specialized adeno-associated virus vector optimized for the production of full-length antibody from muscle tissue and showed that humanized mice receiving VIP appear to be fully protected from HIV infection, even when challenged intravenously with very high doses of replication-competent virus. Their results suggest that successful translation of this approach to humans may produce effective prophylaxis against HIV.

How can we test for the presence of the CCR5-D32 allele?

The purification of genomic DNA from cellular contaminations present in mammalian blood involves four stages:

1.  Disruption of cells;

2.  Lysis of cells;

3.  Removal of proteins and other contaminants; and,

4.  Recovery of DNA.

Protocol:

  1. Extract genomic DNA in volumes of 0.5 to 10 ml of peripheral blood using a salt extraction step with a sodium chloride (0.15 M), sodium citrate (0.015 M) buffer.
  2. Amplify ca. hundred ngs of DNA by PCR.
  3. Use primers for the CCR5-Delta 32 allele CCR5-D32- and CCR5-D32-R:
  4. Separate PCR fragments of 196 bp and 164 bp for wt and Delta 32 alleles using 2% agarose gelelectrophoresis
  5. Follow up by sequence analysis to confirm the presence of the C77G variant.

To ensure that the allele is present prior to subjecting the amplified DNA fragment to sequence analysis perform the following steps:

  1. Amplify the wt allele using two primer pairs – CCR5-F1 and CCR5-R1, CCR5-F’ and CCR5-R2.
  2. Obtain a fragment including the mutation for the CD45-C77G allele by using primers CD45-F and CD45-R, and perform a subsequent HpaII digestion of the PCR products. Analysis by agarose gel electrophoresis of the fragments will show the presence of the mutated allele.

Amplification Primers:

CCR5-D32-F: 5’CTTCATTACACCTGCAGCT3′

CCR5-D32-R: 5’TGAAGATAAGCCTCACAGCC3′

Sequencing Primers:

CCR5-F1: 5’ATGGAGGGCAACTAAATACATT3′

CCR5-R1: 5’AGATGACTATCTTTAATGTCTG3′

CCR5-F2: 5’CTCTCATTTTCCATACAGTCAGTATCA3′

CCR5-R2: 5’AAGCCATGTGCACAACTCTGACTG3′

Host cytotoxic lymphocites (CTL) and recognition of HIV-1 peptides

Rolland et al in 2007 analyzed the extent of similarity between HIV-1 and the human proteome to better understand the reported dominance patters among responses to HIV-1 antigens. The researchers selected proteins from the HIV-1 B consensus sequence published in 2001 and dissected them into overlapping multimeric peptides using peptide libraries of 4, 5, 6 or 9 mers which they probed using bioinformatic methods against a non-redundant database of the human proteome in order to identify segments of high similarity. Human immunodeficiency virus type 1 (HIV-1)-specific cytotoxic T lymphocytes preferentially target specific regions of the viral proteome however HIV-1 specific features that contribute to immune recognition are not well understood. The cytotoxic T cell, also known as TC, Cytotoxic T Lymphocyte, CTL, T-Killer cell, cytolytic T cell, CD8+ T-cells or killer T cell, is a type of white blood cell that can kill cancer cells, infected cells, and other damaged cells. To do so the cytotoxic T cells express T-cell receptors (TCRs) that can recognize specific antigens. The working hypothesis used assumes that similarities between HIV and human proteins influence the host immune response and resemblances between viral and host peptides could preclude reactivity against certain HIV epitopes and that antigenic motifs rarely represented in human proteins are more likely to be CTL targets for the host. The research group tested the relationship between HIV-1 similarity to host encoded peptides and immune recognition in HIV-infected individuals, and found that HIV immunogenicity could be partially modulated by the sequences similar to the host proteome. To achieve these results they used an ELISpot assay to detect antigen-specific CD4+ T-cell responses to peptides spanning the entire viral proteome evaluated in 314 individuals. The observed results showed a trend that indicated an inverse relationship between the similarity to the host proteome and the frequency of recognition. Their results suggest that antigenic motifs that are rarely represented in human proteins might represent more immunogenic CTL targets not selected against in the host. The researchers state that “this observation could provide guidance in the design of more effective HIV immunogens, as sequences devoid of host-like features might afford superior immune reactivity.” The ELIspot assay (enzyme-linked immunospot) used involves the use of overlapping synthetic peptides, 10 mer peptides overlapping by 9 amino acids, to screen for HIV-specific T-cell responses. Basically, the peptides are spotted on PVDF membranes in a 96 well format that were pretreated with anti-gamma interferon monoclonal antibody (IFN-g) 1-D1K, followed by incubation with the cells to be investigated at 37°C overnight. Next, the membrane spots were developed with a biotinylated anti-IFN-g monoclonal antibody 7-B6-1, followed by incubation with a dilution of streptavidin-coupled alkaline phosphatase. The resulting T-cell antibody complex was detected by the incubation with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate. The colored spots were then counted and expressed as spot-forming cells (Frahm et al. 2004).

To conclude, CTL peptide libraries and pools as well as other corresponding peptide libraries can be used to identify factors that contribute to the immunogenicity of highly targeted and relatively conserved sequences in HIV. The resulting list of identified HIV peptides may represent candidates useful for the development of vaccines for ethnically heterogeneous populations. However, the peptide based methods described her are not just limited to the study of viruses. If modified accordingly they can be used for the investigation of any other pathogen as well.

References

Allers K et al. Evidence for the cure of HIV infection by CCR5Δ32/ Δ32 stem cell transplantation. Blood, advance online publication December 8, 2010.

Alejandro B. Balazs, Joyce Chen, Christin M. Hong, Dinesh S. Rao, Lili Yang & David Baltimore; Antibody-based protection against HIV infection by vectored immunoprophylaxis. Nature 481, 81–84.

Barcellos, et al., CC-chemokine receptor 5 polymorphism and age of onset in familial multiple sclerosis, Immunogenetics 51(4–5):281–288, 2000.

Belnoue, et al., CCR5 deficiency decreases susceptibility to experimental cerebral malaria, Blood 101(11):4253–4259, 2003.

Duncan, et al., Reappraisal of the historical selective pressures for the CCR5-delta32 mutation, Journal of Medical Genetics 42(3):205–208, March 2005.

Elvin, et al., Ambiguous role of CCR5 in Y. pestis infection, Nature 430(6998):417, 22 July 2004.

Eri, R, et al., CCR5-Delta 32 mutation is strongly associated with primary sclerosing cholangitis, Genes And Immunity 5(6):444–450, September 2004, <http://www.nature.com/gene/journal/v5/n6/full/6364113a.html&gt;.

Eric Faure, Manuela Royer-Carenzi; Is the European spatial distribution of the HIV-1-resistant CCR5-D32 allele formed by a breakdown of the pathocenosis due to the historical Roman expansion? Infection, Genetics and Evolution 8 (2008) 864–874.

Frahm N, Korber BT, Adams CM, Szinger JJ, Draenert R, et al. (2004) Consistent cytotoxic-T-lymphocyte targeting of immunodominant regions in human immunodeficiency virus across multiple ethnicities. J Virol 78: 2187–2200.

Galvani, A. P.and Slatkin, M., Evaluating plague and smallpox as historical selective pressures for the CCR5-delta-32 HIV-resistance allele, Proceedings of the National Academy of Sciences of the USA 100(25):15276–15279, 9 December 2003.

HIV data base: http://www.hiv.lanl.gov/content/immunology/tools-links.html

HIV info:  http://hivdb.stanford.edu/

Hutter G et al. Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS. J Int AIDS Soc 12: 10, 2009.

Hutter G et al. Long-term control of HIV by CCR5 CCR5Δ32/ Δ32 stem-cell transplantation. N Engl J Med. 360: 692-8, 2009.

Qingwen Jin, Jon Marsh, Kenneth Cornetta, and Ghalib  Alkhatib; Resistance to human immunodeficiency virus type 1 (HIV-1) generated by lentivirus vector-mediated delivery of the CCR5Δ32 gene despite detectable expression of the HIV-1 co-receptors  J Gen Virol. 2008 October ; 89(Pt 10): 2611–2621.

Kantor, et al., A mutated CCR5 gene may have favorable prognostic implications in MS, Neurology 61(2):238–240, 2003.

Cohen, J., Building an HIV-proof immune system, Science 317(5838):612–614, 3 August 2007; page 613.

Kawamura, et al., R5 HIV productively infects Langerhans cells, and infection levels are regulated by compound CCR5 polymorphisms, Proceedings of the National Academy of Sciences of the USA 100(14):8401–8406, 2003.

Lin-tai Da and Yun-Dong Wu; Theoretical Studies on the Interactions and Interferences of HIV-1 Glycoprotein gp120 and Its Coreceptor CCR5J. Chem. Inf. Model. 2011, 51, 359–369.

Liu, et al., Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection, Cell 86(3):367–377, 9 August 1996.

Gérard Lucotte, Florent Dieterlen; More about the Viking hypothesis of origin of the D32 mutation in the CCR5 gene conferring resistance to HIV-1 infection. Short communication Infection, Genetics and Evolution 3 (2003) 293–295.

Majumder and Dey, Absence of the HIV-1 protective del-ccr5 allele in most ethnic populations of India, European Journal of Human Genetics 9(10):794–796, October 2001.

Mecsas, et al., CCR5 mutation and plague protection, Nature 427(6998): 606, 22 July 2004.

Rolland M, Nickle DC, Deng W, Frahm N, Brander C, et al (2007) Recognition of HIV-1 Peptides by Host CTL Is Related to HIV-1 Similarity to Human Proteins. PLoS ONE 2(9): e823. doi:10.1371/journal.pone.0000823

Rottman, et al., Cellular localization of the chemokine receptor CCR5: correlation to cellular targets of HIV-1 infection, The American Journal of Pathology 151(5):1341–1351, 1997.

Sergi Veloso, Montserrat Olona, Felipe Garcia, Pere Domingo, Carlos Alonso-Villaverde, Montserrat Broch, Joaquim Peraire, Consuelo Vilades, Montserrat Plana, Enric Pedrol, Miguel Lopez-Dupla, Carmen Aguilar, Mar Gutierrez, Agathe Leon, Mariona Tasias, Josep Ma Gatell,Cristobal Richart and Francesc Vidal;Effecttof TNF-α genetic variants and CCR5Δ32 on the vulnerability to HIV-1 infection and disease progression in Caucasian Spaniards.  BMC Medical Genetics 2010, 11:63.

Stephens, et al., Dating the origin of the CCR5-del32 AIDS-resistance allele by the coalescence of haplotypes, American Journal of Human Genetics 62(6):1507–1515, June 1998.

The HIV-1 subtype B consensus sequence of 2001 available at the HIV immunology database (http://www.hiv.lanl.gov/content/hiv-db/PEPTGEN/2001.html).

The search for a cure > http://www.aidsmap.com/page/1577949/

Zagury, et al., C-C chemokines, pivotal in protection against HIV type 1 infection, Proceedings of the National Academy of Sciences of the USA 95(7):3857–3861, 1998.

Zimmerman, et al., Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk, Molecular Medicine 3(1):23–36, 1997.



Categories: Bioanalysis, BNA RNA, DNA, DNA Analysis, Genetics, Human Genetics, peptides, Synthesis

Tags: , , , , , , , , , , , , , , , , , , ,

1 reply

  1. Greetings! Very helpful advice within this post! It is the little changes
    which will make the biggest changes. Thanks for sharing!

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: